SAVE 40% ON SINGLE IMAGE PURCHASES - OFFER ENDS SOON, USE CODE: SAVEIMAGE40%
Page 1 of 1
Applied biosystems Stock Photos and Images
automatic sequencer, GENETIC ANALIZER 3130XL Applied Biosystems allows automatic sequencing of DNA fragments The instrument performs the separation of DNA fragments according to size capillary electrophoresis, the detection and recording of fluorescence For the analysis of the sequences obtained specific software is used, Biotechnology Laboratory, Health Area, Alava Technology Park, Technology Centre, Tecnalia Research & Innovation, Miñano, Araba, Basque Country, Spain. Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/automatic-sequencer-genetic-analizer-3130xl-applied-biosystems-allows-automatic-sequencing-of-dna-fragments-the-instrument-performs-the-separation-of-dna-fragments-according-to-size-capillary-electrophoresis-the-detection-and-recording-of-fluorescence-for-the-analysis-of-the-sequences-obtained-specific-software-is-used-biotechnology-laboratory-health-area-alava-technology-park-technology-centre-tecnalia-research-innovation-miano-araba-basque-country-spain-image602321772.htmlRM2WYX3FT–automatic sequencer, GENETIC ANALIZER 3130XL Applied Biosystems allows automatic sequencing of DNA fragments The instrument performs the separation of DNA fragments according to size capillary electrophoresis, the detection and recording of fluorescence For the analysis of the sequences obtained specific software is used, Biotechnology Laboratory, Health Area, Alava Technology Park, Technology Centre, Tecnalia Research & Innovation, Miñano, Araba, Basque Country, Spain.
Archive image from page 280 of dan bai zhi hua xue. dan bai zhi hua xue yu dan bai zhi zu xue danbaizhihuaxuey00xiaq Year: 2004.4 MALDE-TOFMS å¾13.8质谱æåæ¯ a) å°äºæ¶²æ°®ä¿å-çæ°é²ç»ç»ï¼åå²æè¿ç»-çåå°å»ç»ç»åçã b) æ 污æçç®æ é¢æ¿ä¸æ¾ç½®ä¸çå°å»ç»ç»åçï¼è¦çåºè´¨ç¼å²æ¶²åè±æ°´ã C) MALDI-MS( Voyager Elite DE , Applied Biosystems, Framingham, Massachusetts) åæ:æ ·å表é¢çæ¯ä¸ªè¯æ å¾ï¼raster)以è¿ç»-çæ¿å ç¹ï¼ç´å¾25ptm)ç §å°ï¼åºå®æ¿å ä½ç½®ï¼ 移å¨æ ·åç;æ¯ä¸ªæ¿å ç §å°ç¹äº§çç §å°é¨åçæ ·åä¿¡æ¯ãå¹³åæ¯50次æ¿å ç §å°äº§çä¸ä¸ª fast transient recorder PC board (DP211ï¼ Acqiris,Geeva, Switzerland)ï¼æ¯ä¸ªç §å°ç¹ Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/archive-image-from-page-280-of-dan-bai-zhi-hua-xue-dan-bai-zhi-hua-xue-yu-dan-bai-zhi-zu-xue-danbaizhihuaxuey00xiaq-year-20044-malde-tofms-138-a-b-c-maldi-ms-voyager-elite-de-applied-biosystems-framingham-massachusetts-raster-25ptm-50-fast-transient-recorder-pc-board-dp211-acqirisgeeva-switzerland-image259551995.htmlRMW27H63–Archive image from page 280 of dan bai zhi hua xue. dan bai zhi hua xue yu dan bai zhi zu xue danbaizhihuaxuey00xiaq Year: 2004.4 MALDE-TOFMS å¾13.8质谱æåæ¯ a) å°äºæ¶²æ°®ä¿å-çæ°é²ç»ç»ï¼åå²æè¿ç»-çåå°å»ç»ç»åçã b) æ 污æçç®æ é¢æ¿ä¸æ¾ç½®ä¸çå°å»ç»ç»åçï¼è¦çåºè´¨ç¼å²æ¶²åè±æ°´ã C) MALDI-MS( Voyager Elite DE , Applied Biosystems, Framingham, Massachusetts) åæ:æ ·å表é¢çæ¯ä¸ªè¯æ å¾ï¼raster)以è¿ç»-çæ¿å ç¹ï¼ç´å¾25ptm)ç §å°ï¼åºå®æ¿å ä½ç½®ï¼ 移å¨æ ·åç;æ¯ä¸ªæ¿å ç §å°ç¹äº§çç §å°é¨åçæ ·åä¿¡æ¯ãå¹³åæ¯50次æ¿å ç §å°äº§çä¸ä¸ª fast transient recorder PC board (DP211ï¼ Acqiris,Geeva, Switzerland)ï¼æ¯ä¸ªç §å°ç¹
DNA Sequencer Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/stock-photo-dna-sequencer-135019754.htmlRMHRJK22–DNA Sequencer
Kiel, Germany, a laboratory assistant in the DNA laboratory of the LKA Schleswig-Holstein Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/stock-photo-kiel-germany-a-laboratory-assistant-in-the-dna-laboratory-of-the-lka-56014863.htmlRMD73KER–Kiel, Germany, a laboratory assistant in the DNA laboratory of the LKA Schleswig-Holstein
. The Biological bulletin. Biology; Zoology; Biology; Marine Biology. SPECIAL GIFTS R7I Other Gifts. A variety of foundations, individuals, and companies provided funds for special projects and programs at the Marine Biological Laboratory. We gratefully acknowledge their support. Major Gifts Anonymous (2) American Society for Cell Biology American Society for Reproductive Medicine Applied Biosystems Cox Foundation, Inc Estate of Emily Ann Cramer Environmental Data Research Institute ExxonMobil Foundation Georgia-Pacific Corporation Mr William Golden and Dr Jean Taylor Howard Hughes Medical Ins Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/the-biological-bulletin-biology-zoology-biology-marine-biology-special-gifts-r7i-other-gifts-a-variety-of-foundations-individuals-and-companies-provided-funds-for-special-projects-and-programs-at-the-marine-biological-laboratory-we-gratefully-acknowledge-their-support-major-gifts-anonymous-2-american-society-for-cell-biology-american-society-for-reproductive-medicine-applied-biosystems-cox-foundation-inc-estate-of-emily-ann-cramer-environmental-data-research-institute-exxonmobil-foundation-georgia-pacific-corporation-mr-william-golden-and-dr-jean-taylor-howard-hughes-medical-ins-image234542223.htmlRMRHG8YY–. The Biological bulletin. Biology; Zoology; Biology; Marine Biology. SPECIAL GIFTS R7I Other Gifts. A variety of foundations, individuals, and companies provided funds for special projects and programs at the Marine Biological Laboratory. We gratefully acknowledge their support. Major Gifts Anonymous (2) American Society for Cell Biology American Society for Reproductive Medicine Applied Biosystems Cox Foundation, Inc Estate of Emily Ann Cramer Environmental Data Research Institute ExxonMobil Foundation Georgia-Pacific Corporation Mr William Golden and Dr Jean Taylor Howard Hughes Medical Ins
. dan bai zhi hua xue yu dan bai zhi zu xue. botany. MALDE-TOFMS å¾13.8质谱æåæ¯ a) å°äºæ¶²æ°®ä¿å-çæ°é²ç»ç»ï¼åå²æè¿ç»-çåå°å»ç»ç»åçã b) æ 污æçç®æ é¢æ¿ä¸æ¾ç½®ä¸çå°å»ç»ç»åçï¼è¦çåºè´¨ç¼å²æ¶²åè±æ°´ã C) MALDI-MS( Voyager Elite DE , Applied Biosystems, Framingham, Massachusetts) åæ:æ ·å表é¢çæ¯ä¸ªè¯æ å¾ï¼raster)以è¿ç»-çæ¿å ç¹ï¼ç´å¾25ptm)ç §å°ï¼åºå®æ¿å ä½ç½®ï¼ 移å¨æ ·åç;æ¯ä¸ªæ¿å ç §å°ç¹äº§çç §å°é¨åçæ ·åä¿¡æ¯ãå¹³åæ¯50次æ¿å ç §å°äº§çä¸ä¸ª fast transient recorder PC board (DP211ï¼ Acqiris,Geeva, Switzerland)ï¼æ¯ä¸ªç §å°ç¹ä¿¡æ¯ç å¤çéè¦çº¦2.5s; âä¸ªå ¸åçä¿¡æ¯ç¹éµæ ¹æ®æåè´¨éè¦æ±éè¦1 000ã30 000ä¸ªç §å°ç Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/dan-bai-zhi-hua-xue-yu-dan-bai-zhi-zu-xue-botany-malde-tofms-138-a-b-c-maldi-ms-voyager-elite-de-applied-biosystems-framingham-massachusetts-raster-25ptm-50-fast-transient-recorder-pc-board-dp211-acqirisgeeva-switzerland-25s-1-00030-000-image216157568.htmlRMPFJR54–. dan bai zhi hua xue yu dan bai zhi zu xue. botany. MALDE-TOFMS å¾13.8质谱æåæ¯ a) å°äºæ¶²æ°®ä¿å-çæ°é²ç»ç»ï¼åå²æè¿ç»-çåå°å»ç»ç»åçã b) æ 污æçç®æ é¢æ¿ä¸æ¾ç½®ä¸çå°å»ç»ç»åçï¼è¦çåºè´¨ç¼å²æ¶²åè±æ°´ã C) MALDI-MS( Voyager Elite DE , Applied Biosystems, Framingham, Massachusetts) åæ:æ ·å表é¢çæ¯ä¸ªè¯æ å¾ï¼raster)以è¿ç»-çæ¿å ç¹ï¼ç´å¾25ptm)ç §å°ï¼åºå®æ¿å ä½ç½®ï¼ 移å¨æ ·åç;æ¯ä¸ªæ¿å ç §å°ç¹äº§çç §å°é¨åçæ ·åä¿¡æ¯ãå¹³åæ¯50次æ¿å ç §å°äº§çä¸ä¸ª fast transient recorder PC board (DP211ï¼ Acqiris,Geeva, Switzerland)ï¼æ¯ä¸ªç §å°ç¹ä¿¡æ¯ç å¤çéè¦çº¦2.5s; âä¸ªå ¸åçä¿¡æ¯ç¹éµæ ¹æ®æåè´¨éè¦æ±éè¦1 000ã30 000ä¸ªç §å°ç
automatic sequencer, GENETIC ANALIZER 3130XL Applied Biosystems allows automatic sequencing of DNA fragments The instrument performs the separation of DNA fragments according to size capillary electrophoresis, the detection and recording of fluorescence For the analysis of the sequences obtained specific software is used, Biotechnology Laboratory, Health Area, Alava Technology Park, Technology Centre, Tecnalia Research & Innovation, Miñano, Araba, Basque Country, Spain. Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/automatic-sequencer-genetic-analizer-3130xl-applied-biosystems-allows-automatic-sequencing-of-dna-fragments-the-instrument-performs-the-separation-of-dna-fragments-according-to-size-capillary-electrophoresis-the-detection-and-recording-of-fluorescence-for-the-analysis-of-the-sequences-obtained-specific-software-is-used-biotechnology-laboratory-health-area-alava-technology-park-technology-centre-tecnalia-research-innovation-miano-araba-basque-country-spain-image602224619.htmlRM2WYNKJ3–automatic sequencer, GENETIC ANALIZER 3130XL Applied Biosystems allows automatic sequencing of DNA fragments The instrument performs the separation of DNA fragments according to size capillary electrophoresis, the detection and recording of fluorescence For the analysis of the sequences obtained specific software is used, Biotechnology Laboratory, Health Area, Alava Technology Park, Technology Centre, Tecnalia Research & Innovation, Miñano, Araba, Basque Country, Spain.
Kiel, Germany, a laboratory assistant in the DNA laboratory of the LKA Schleswig-Holstein Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/stock-photo-kiel-germany-a-laboratory-assistant-in-the-dna-laboratory-of-the-lka-56014868.htmlRMD73KF0–Kiel, Germany, a laboratory assistant in the DNA laboratory of the LKA Schleswig-Holstein
. Bonner zoologische Beiträge : Herausgeber: Zoologisches Forschungsinstitut und Museum Alexander Koenig, Bonn. Biology; Zoology. Fig. 3: Holotype male genitalia. out using an ABI 377 automated sequencer (Applied Biosystems). Up to 10 single sequences per individual were assembled and aligned to the COI gene of Bombyx morí (L., 1758) (Lepidoptera, Bombycidae; GenBank accession number NC 002355). Result: The following sequence of P. naumaimiella sp. nov. shows the partial COI gene of the holotype: >Paracymoriza nauman n i e 1 la H o 1 otype DNATAX02820J 230bp CGAAAATGACTTTATTCTACAAATCATAAAG Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/bonner-zoologische-beitrge-herausgeber-zoologisches-forschungsinstitut-und-museum-alexander-koenig-bonn-biology-zoology-fig-3-holotype-male-genitalia-out-using-an-abi-377-automated-sequencer-applied-biosystems-up-to-10-single-sequences-per-individual-were-assembled-and-aligned-to-the-coi-gene-of-bombyx-mor-l-1758-lepidoptera-bombycidae-genbank-accession-number-nc-002355-result-the-following-sequence-of-p-naumaimiella-sp-nov-shows-the-partial-coi-gene-of-the-holotype-gtparacymoriza-nauman-n-i-e-1-la-h-o-1-otype-dnatax02820j-230bp-cgaaaatgactttattctacaaatcataaag-image234488120.htmlRMRHDRYM–. Bonner zoologische Beiträge : Herausgeber: Zoologisches Forschungsinstitut und Museum Alexander Koenig, Bonn. Biology; Zoology. Fig. 3: Holotype male genitalia. out using an ABI 377 automated sequencer (Applied Biosystems). Up to 10 single sequences per individual were assembled and aligned to the COI gene of Bombyx morí (L., 1758) (Lepidoptera, Bombycidae; GenBank accession number NC 002355). Result: The following sequence of P. naumaimiella sp. nov. shows the partial COI gene of the holotype: >Paracymoriza nauman n i e 1 la H o 1 otype DNATAX02820J 230bp CGAAAATGACTTTATTCTACAAATCATAAAG
automatic sequencer, GENETIC ANALIZER 3130XL Applied Biosystems allows automatic sequencing of DNA fragments The instrument performs the separation of DNA fragments according to size capillary electrophoresis, the detection and recording of fluorescence For the analysis of the sequences obtained specific software is used, Biotechnology Laboratory, Health Area, Alava Technology Park, Technology Centre, Tecnalia Research & Innovation, Miñano, Araba, Basque Country, Spain. Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/automatic-sequencer-genetic-analizer-3130xl-applied-biosystems-allows-automatic-sequencing-of-dna-fragments-the-instrument-performs-the-separation-of-dna-fragments-according-to-size-capillary-electrophoresis-the-detection-and-recording-of-fluorescence-for-the-analysis-of-the-sequences-obtained-specific-software-is-used-biotechnology-laboratory-health-area-alava-technology-park-technology-centre-tecnalia-research-innovation-miano-araba-basque-country-spain-image602125670.htmlRM2WYH5C6–automatic sequencer, GENETIC ANALIZER 3130XL Applied Biosystems allows automatic sequencing of DNA fragments The instrument performs the separation of DNA fragments according to size capillary electrophoresis, the detection and recording of fluorescence For the analysis of the sequences obtained specific software is used, Biotechnology Laboratory, Health Area, Alava Technology Park, Technology Centre, Tecnalia Research & Innovation, Miñano, Araba, Basque Country, Spain.
Kiel, Germany, a laboratory technician at the sequencer in the DNA laboratory of the LKA Schleswig-Holstein Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/stock-photo-kiel-germany-a-laboratory-technician-at-the-sequencer-in-the-dna-laboratory-56014860.htmlRMD73KEM–Kiel, Germany, a laboratory technician at the sequencer in the DNA laboratory of the LKA Schleswig-Holstein
. Bonner zoologische Beiträge : Herausgeber: Zoologisches Forschungsinstitut und Museum Alexander Koenig, Bonn. Biology; Zoology. Wolfgang SPEIDEL, UlfBl < HSBAUM & Michael A. Mili 11<: A New Paracymoriza Species from Lombok (Indonesia) 229. Fig. 3: Holotype male genitalia. out using an ABI 377 automated sequencer (Applied Biosystems). Up to 10 single sequences per individual were assembled and aligned to the COI gene of Bombyx morí (L., 1758) (Lepidoptera, Bombycidae; GenBank accession number NC 002355). Result: The following sequence of P. naumaimiella sp. nov. shows the partial CO Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/bonner-zoologische-beitrge-herausgeber-zoologisches-forschungsinstitut-und-museum-alexander-koenig-bonn-biology-zoology-wolfgang-speidel-ulfbl-lt-hsbaum-amp-michael-a-mili-11lt-a-new-paracymoriza-species-from-lombok-indonesia-229-fig-3-holotype-male-genitalia-out-using-an-abi-377-automated-sequencer-applied-biosystems-up-to-10-single-sequences-per-individual-were-assembled-and-aligned-to-the-coi-gene-of-bombyx-mor-l-1758-lepidoptera-bombycidae-genbank-accession-number-nc-002355-result-the-following-sequence-of-p-naumaimiella-sp-nov-shows-the-partial-co-image234488128.htmlRMRHDT00–. Bonner zoologische Beiträge : Herausgeber: Zoologisches Forschungsinstitut und Museum Alexander Koenig, Bonn. Biology; Zoology. Wolfgang SPEIDEL, UlfBl < HSBAUM & Michael A. Mili 11<: A New Paracymoriza Species from Lombok (Indonesia) 229. Fig. 3: Holotype male genitalia. out using an ABI 377 automated sequencer (Applied Biosystems). Up to 10 single sequences per individual were assembled and aligned to the COI gene of Bombyx morí (L., 1758) (Lepidoptera, Bombycidae; GenBank accession number NC 002355). Result: The following sequence of P. naumaimiella sp. nov. shows the partial CO
. The Biological bulletin. Biology; Zoology; Biology; Marine Biology. Figure 2. Representative results of amplification of the repetitive region of the adhesive protein gene. Amplified products were electro- phoresed on l% agarose gel. Lanes I and 2. Mylili eilitlis: lanes 3 and 4, M. irossuhts: lanes 5 and 6, M. galloprovincialis. M, molecular marker (lambda DNA digested with £«>T 141). inserted into the Sma I site of pUC19. Sequences of both strands of three independent clones were determined using a 373A DNA sequencer (Applied Biosystems Inc.) and a PRISM Dyeterminator Cycle Sequencing Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/the-biological-bulletin-biology-zoology-biology-marine-biology-figure-2-representative-results-of-amplification-of-the-repetitive-region-of-the-adhesive-protein-gene-amplified-products-were-electro-phoresed-on-l-agarose-gel-lanes-i-and-2-mylili-eilitlis-lanes-3-and-4-m-irossuhts-lanes-5-and-6-m-galloprovincialis-m-molecular-marker-lambda-dna-digested-with-gtt-141-inserted-into-the-sma-i-site-of-puc19-sequences-of-both-strands-of-three-independent-clones-were-determined-using-a-373a-dna-sequencer-applied-biosystems-inc-and-a-prism-dyeterminator-cycle-sequencing-image234630365.htmlRMRHM9BW–. The Biological bulletin. Biology; Zoology; Biology; Marine Biology. Figure 2. Representative results of amplification of the repetitive region of the adhesive protein gene. Amplified products were electro- phoresed on l% agarose gel. Lanes I and 2. Mylili eilitlis: lanes 3 and 4, M. irossuhts: lanes 5 and 6, M. galloprovincialis. M, molecular marker (lambda DNA digested with £«>T 141). inserted into the Sma I site of pUC19. Sequences of both strands of three independent clones were determined using a 373A DNA sequencer (Applied Biosystems Inc.) and a PRISM Dyeterminator Cycle Sequencing
. The Biological bulletin. Biology; Zoology; Biology; Marine Biology. Figure 2. RFLP genotypes A, B, C, and E of Symbiodinium obtained from different colonies of Montastraea frank.ii. srDNAs were amplified with host-excluding PCR primers and digested with Dpn II (left) and with Taq I (right). Lane M contains DNA fragment size standards of (top to bottom) 1500 base pairs (bp). 1200 bp, and then 1000 hp to 100 bp in 100-bp increments. 373 sequencer (Applied Biosystems, Foster City, CA) and complete sequences were assembled using SeqEd software (Applied Biosystems). RFLP genotypes of cloned srDNA Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/the-biological-bulletin-biology-zoology-biology-marine-biology-figure-2-rflp-genotypes-a-b-c-and-e-of-symbiodinium-obtained-from-different-colonies-of-montastraea-frankii-srdnas-were-amplified-with-host-excluding-pcr-primers-and-digested-with-dpn-ii-left-and-with-taq-i-right-lane-m-contains-dna-fragment-size-standards-of-top-to-bottom-1500-base-pairs-bp-1200-bp-and-then-1000-hp-to-100-bp-in-100-bp-increments-373-sequencer-applied-biosystems-foster-city-ca-and-complete-sequences-were-assembled-using-seqed-software-applied-biosystems-rflp-genotypes-of-cloned-srdna-image234541961.htmlRMRHG8JH–. The Biological bulletin. Biology; Zoology; Biology; Marine Biology. Figure 2. RFLP genotypes A, B, C, and E of Symbiodinium obtained from different colonies of Montastraea frank.ii. srDNAs were amplified with host-excluding PCR primers and digested with Dpn II (left) and with Taq I (right). Lane M contains DNA fragment size standards of (top to bottom) 1500 base pairs (bp). 1200 bp, and then 1000 hp to 100 bp in 100-bp increments. 373 sequencer (Applied Biosystems, Foster City, CA) and complete sequences were assembled using SeqEd software (Applied Biosystems). RFLP genotypes of cloned srDNA
. The Biological bulletin. Biology; Zoology; Biology; Marine Biology. 372 K. INDUE ET AL. 123 456. Figure 2. Representative results of amplification of the repetitive region of the adhesive protein gene. Amplified products were electro- phoresed on l% agarose gel. Lanes I and 2. Mylili eilitlis: lanes 3 and 4, M. irossuhts: lanes 5 and 6, M. galloprovincialis. M, molecular marker (lambda DNA digested with £«>T 141). inserted into the Sma I site of pUC19. Sequences of both strands of three independent clones were determined using a 373A DNA sequencer (Applied Biosystems Inc.) and a PRISM Dy Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/the-biological-bulletin-biology-zoology-biology-marine-biology-372-k-indue-et-al-123-456-figure-2-representative-results-of-amplification-of-the-repetitive-region-of-the-adhesive-protein-gene-amplified-products-were-electro-phoresed-on-l-agarose-gel-lanes-i-and-2-mylili-eilitlis-lanes-3-and-4-m-irossuhts-lanes-5-and-6-m-galloprovincialis-m-molecular-marker-lambda-dna-digested-with-gtt-141-inserted-into-the-sma-i-site-of-puc19-sequences-of-both-strands-of-three-independent-clones-were-determined-using-a-373a-dna-sequencer-applied-biosystems-inc-and-a-prism-dy-image234630392.htmlRMRHM9CT–. The Biological bulletin. Biology; Zoology; Biology; Marine Biology. 372 K. INDUE ET AL. 123 456. Figure 2. Representative results of amplification of the repetitive region of the adhesive protein gene. Amplified products were electro- phoresed on l% agarose gel. Lanes I and 2. Mylili eilitlis: lanes 3 and 4, M. irossuhts: lanes 5 and 6, M. galloprovincialis. M, molecular marker (lambda DNA digested with £«>T 141). inserted into the Sma I site of pUC19. Sequences of both strands of three independent clones were determined using a 373A DNA sequencer (Applied Biosystems Inc.) and a PRISM Dy
. The Biological bulletin. Biology; Zoology; Biology; Marine Biology. PIGMENT-DISPERSING HORMONE 141 800 - N | 600 •I 400 0 1 200 N M n K n N 1 3 5 7 9 11 13 15 17 Cycle Number 19 FIGURE 5. Yields of amino acid residues during the sequence analysis of Cancer PDH (1.68 nmol load) by stepwise Edman degradation, utilizing a gas-phase automated sequencer (Model 470 A, Applied Biosystems), coupled with HPLC identification of the resulting PTH-amino acids. Nomenclature of amino acids by the one-letter code: A (Ala), D (Asp), E (Glu), G (Gly), I (He), K (Lys), L (Leu), M (Met), N (Asn), P (Pro)', S ( Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/the-biological-bulletin-biology-zoology-biology-marine-biology-pigment-dispersing-hormone-141-800-n-600-i-400-0-1-200-n-m-n-k-n-n-1-3-5-7-9-11-13-15-17-cycle-number-19-figure-5-yields-of-amino-acid-residues-during-the-sequence-analysis-of-cancer-pdh-168-nmol-load-by-stepwise-edman-degradation-utilizing-a-gas-phase-automated-sequencer-model-470-a-applied-biosystems-coupled-with-hplc-identification-of-the-resulting-pth-amino-acids-nomenclature-of-amino-acids-by-the-one-letter-code-a-ala-d-asp-e-glu-g-gly-i-he-k-lys-l-leu-m-met-n-asn-p-pro-s-image234646730.htmlRMRHN28A–. The Biological bulletin. Biology; Zoology; Biology; Marine Biology. PIGMENT-DISPERSING HORMONE 141 800 - N | 600 •I 400 0 1 200 N M n K n N 1 3 5 7 9 11 13 15 17 Cycle Number 19 FIGURE 5. Yields of amino acid residues during the sequence analysis of Cancer PDH (1.68 nmol load) by stepwise Edman degradation, utilizing a gas-phase automated sequencer (Model 470 A, Applied Biosystems), coupled with HPLC identification of the resulting PTH-amino acids. Nomenclature of amino acids by the one-letter code: A (Ala), D (Asp), E (Glu), G (Gly), I (He), K (Lys), L (Leu), M (Met), N (Asn), P (Pro)', S (
. dan bai zhi hua xue yu dan bai zhi zu xue. botany. MALDE-TOFMS å¾13.8质谱æåæ¯ a) å°äºæ¶²æ°®ä¿å-çæ°é²ç»ç»ï¼åå²æè¿ç»-çåå°å»ç»ç»åçã b) æ 污æçç®æ é¢æ¿ä¸æ¾ç½®ä¸çå°å»ç»ç»åçï¼è¦çåºè´¨ç¼å²æ¶²åè±æ°´ã C) MALDI-MS( Voyager Elite DE , Applied Biosystems, Framingham, Massachusetts) åæ:æ ·å表é¢çæ¯ä¸ªè¯æ å¾ï¼raster)以è¿ç»-çæ¿å ç¹ï¼ç´å¾25ptm)ç §å°ï¼åºå®æ¿å ä½ç½®ï¼ 移å¨æ ·åç;æ¯ä¸ªæ¿å ç §å°ç¹äº§çç §å°é¨åçæ ·åä¿¡æ¯ãå¹³åæ¯50次æ¿å ç §å°äº§çä¸ä¸ª fast transient recorder PC board (DP211ï¼ Acqiris,Geeva, Switzerland)ï¼æ¯ä¸ªç §å°ç¹ä¿¡æ¯ç å¤çéè¦çº¦2.5s; âä¸ªå ¸åçä¿¡æ¯ç¹éµæ ¹æ®æåè´¨éè¦æ±éè¦1 000ã30 000ä¸ªç §å°ç Stock Photohttps://www.alamy.com/licenses-and-pricing/?v=1https://www.alamy.com/dan-bai-zhi-hua-xue-yu-dan-bai-zhi-zu-xue-botany-malde-tofms-138-a-b-c-maldi-ms-voyager-elite-de-applied-biosystems-framingham-massachusetts-raster-25ptm-50-fast-transient-recorder-pc-board-dp211-acqirisgeeva-switzerland-25s-1-00030-000-image231750492.htmlRMRD1438–. dan bai zhi hua xue yu dan bai zhi zu xue. botany. MALDE-TOFMS å¾13.8质谱æåæ¯ a) å°äºæ¶²æ°®ä¿å-çæ°é²ç»ç»ï¼åå²æè¿ç»-çåå°å»ç»ç»åçã b) æ 污æçç®æ é¢æ¿ä¸æ¾ç½®ä¸çå°å»ç»ç»åçï¼è¦çåºè´¨ç¼å²æ¶²åè±æ°´ã C) MALDI-MS( Voyager Elite DE , Applied Biosystems, Framingham, Massachusetts) åæ:æ ·å表é¢çæ¯ä¸ªè¯æ å¾ï¼raster)以è¿ç»-çæ¿å ç¹ï¼ç´å¾25ptm)ç §å°ï¼åºå®æ¿å ä½ç½®ï¼ 移å¨æ ·åç;æ¯ä¸ªæ¿å ç §å°ç¹äº§çç §å°é¨åçæ ·åä¿¡æ¯ãå¹³åæ¯50次æ¿å ç §å°äº§çä¸ä¸ª fast transient recorder PC board (DP211ï¼ Acqiris,Geeva, Switzerland)ï¼æ¯ä¸ªç §å°ç¹ä¿¡æ¯ç å¤çéè¦çº¦2.5s; âä¸ªå ¸åçä¿¡æ¯ç¹éµæ ¹æ®æåè´¨éè¦æ±éè¦1 000ã30 000ä¸ªç §å°ç
Search Results for Applied biosystems Stock Photos and Images (17)
Page 1 of 1